The oligo selection engine is the one used in the program OSP.
It is described in
Hillier, L., and Green, P. (1991). "OSP: an oligonucleotide
selection program," PCR Methods and Applications, 1:124-128.
Oligo selection is a complex operation. The normal mode of use is
outlined below:
-
Open the oligo selection window, by selecting "Select Primer" from the
contig editor commands menu.
-
Position the cursor to where you want the oligo to be chosen. While the
oligo selection window is visible, you will still have complete control over
positioning and editing within the contig editor.
-
Indicate the strand for which you require an oligo. This is
done by toggling the direction arrow ("----->" or "<------"), if
necessary.
-
Press the "Find Oligos" button to find all suitable oligos
(see the "Parameters" subsection below for further information on
controlling this procedure). Information for the closest suitable oligo to
the cursor position is given in the output text window. In the
contig editor the position of the oligo is marked by a temporary
tag on the consensus. The window is recentered if the oligo is
off the screen. Selecting "Display Selection Information" will
print a short report on the numbers of oligos considered and
rejected during oligo selection.
-
If this oligo is not suitable (it may have been previously
chosen, and found to be unsuitable by experimentation, say), the
next closest oligo can be viewed by pressing "Select Next".
-
Suitable templates are automatically identified for the
currently displayed oligo (see the "Template selection"
subsection below). By default, the template is that closest to
the oligo site. If the choice is not suitable (it may be known to
be a poor quality template, say) another can be chosen from the
"Choose Template for this Oligo" menu. Templates that do not
appear on the menu can be specified by selecting "other".
However, the template must be on the correct strand and be
upstream of the oligo.
-
A tag can be created for the current oligo by pressing the
button "Create a tag for this oligo". The annotation for this tag
holds the name of the template and the oligo primer sequence.
There are fields to allow the user to specify their own primer
name ("serial#") and comments ("flags") for this tag. An example
of oligo tag annotation:
serial#=
template=a16a9.s1
sequence=CGTTATGACCTATATTTTGTATG
flags=
-
The oligo selection window is closed when "Create a tag for
this oligo" or "Quit" is selected.
The parameters controlling the selection of oligos can be
changed by pressing the "Edit parameters" button. This invokes a
dialogue box which allows the specification of further parameters.
By default, the oligos are selected from a window that extends
40 bases either side of the cursor. The size and location of this
window relative to the cursor position can be changed in the
"Parameters" window.
Primer constraints can be specified by melting temperature, length
and G+C content.
In Gap oligos are ranked according to their proximity to the
cursor position, rather than by their scores.
For simplicity, each reading is considered to represent a
template. In practise, many readings can be made off the same
template. Suitable templates that are identified are those that
satisfy all of the following conditions:
-
are in the appropriate sense,
-
have 5' ends that start upstream of the oligo,
-
are sufficiently close to the oligo to be useful.
This last criterion relates to the insert size for the
templates used for sequencing and the average reading length. A
template is considered useful if a full reading can be made from it,
taking into account both of these factors. The default insert size
is 1000 bases (although the size range should be included in the
experiment file for each reading, and hence the default would not be
required), and the default average reading length is 400 bases.
These values can be changed in the "Parameters" window.
This page is maintained by
James Bonfield.
Last generated on 2 Febuary 1999.
URL: http://www.mrc-lmb.cam.ac.uk/pubseq/manual/gap4_59.html